This application optimises DNA sequences both for codon usage and mRNA secondary structure. It also avoids MluI, XhoI, SalI, SpeI, FseI, AscI, NotI, and AseI restriction sites, Twist fragment adaptors (CAATCCGCCCTCACTACAACCG and CTACTCTGGCGTCGATGAGGGA), repeats of 7-mers (or larger), and optimises GC content.
e.g. H. sapiens = 9606 [default], M. musculus = 10090, D. melanogaster = 7227, D. discoideum = 44689